View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_59 (Length: 339)
Name: NF17793_low_59
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 11 - 323
Target Start/End: Complemental strand, 33815242 - 33814935
Alignment:
| Q |
11 |
gaacctgtgacattattcaaaacttgacaatgtttagggtttatgcataatctgattaacattgctcaacaaattgattaaaattttgacatgtctcaga |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815242 |
gaaccagtgacattattcaaaacttgacaatgtttagggtttatgcataatctgattaacattgctcaacaaattgattaaaattttgacatgtctcaga |
33815143 |
T |
|
| Q |
111 |
aaaatggactattgaatgtagctacttcattttagaagatgatttgatatgtgttgtttttatttgtcttggttccctgtgttgctaatgttgatttaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33815142 |
aaaatggactattgaatgtagctacttcattttagaagatgatttgatatgtgttgtttttatttgtcttggttccctgtgttgctaatg-----ttaac |
33815048 |
T |
|
| Q |
211 |
cgtgaatcaaccacctcttattgaatgtgcacattttagaagatgaaatgtgctgtcttttttggatctgctttggtgttttttgtgtggcctggtccct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815047 |
cgtgaatcaaccacctcttattgaatgtgcacattttagaagatgaaatgtgctgtcttttttggatctgctttggtgttttttgtgtggcctggtccct |
33814948 |
T |
|
| Q |
311 |
gctgtggttagtg |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33814947 |
gctgtggttagtg |
33814935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University