View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_65 (Length: 312)
Name: NF17793_low_65
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 289
Target Start/End: Original strand, 11705912 - 11706192
Alignment:
| Q |
13 |
aatattaattttatgaaattaacctatgacaaactcnnnnnnntattgtctgatcaatcatagcaaagtatagttgtttttcacacttcaaccgtgtatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11705912 |
aatattaattttatgaaattaacctatgacaaactcaaaaaaatattgtctgatcaatcatagcaaagtatagttgtttttcacacttcaaccgtgtatt |
11706011 |
T |
|
| Q |
113 |
aacctttaatgaacctagag----agagagggaggggcaattgacagattataatgaaaagataaaaacctctgtataatttttaaaaatttataatcaa |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11706012 |
aacctttaatgaacctagagagagagagagggaggggcaattgacagattataatgaaaagataaaaacctctgtatattttttaaaaatttataatcaa |
11706111 |
T |
|
| Q |
209 |
atccgacaggctttgaatataaaaataatattgtgaaaagtagtggcatttgcaagtagaaattgcttaattcatttaata |
289 |
Q |
| |
|
|||| ||| ||| ||||||| |||||||||||||||| |||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
11706112 |
atccaacatcttttaaatataataataatattgtgaaaaatagtggtacttgcaagtagaaattgcttaattcatttaata |
11706192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University