View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_67 (Length: 303)
Name: NF17793_low_67
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 288
Target Start/End: Original strand, 6356138 - 6356410
Alignment:
| Q |
16 |
cataggggtggttagtatttatagtagttgatgagattaggatcacaatgttatagttcaaatgaggtgatatttttattcaactactcaattacaacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6356138 |
cataggggtggttagtatttatagtagttgatgagattaggatcacaatgttatagttcaaatgaggtgatatttttattcaactactcatttacaacat |
6356237 |
T |
|
| Q |
116 |
ggtggaatgcaattggtcacgtcttatgctaattttttattatgagtgattttctcgtggtatataaaataataatatatccgattgcaaaattatttgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6356238 |
ggtggaatgcaattggtcacgtcttatgctaattttttattatgagtgattatctcgtggtatataaaataataatatatccgattgcaaaattattttg |
6356337 |
T |
|
| Q |
216 |
gtagttgttatatgtgccagccttggcattatgttcaataataatgactctgtttgctctattgttaattatt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6356338 |
gtagttgttatatgtgccagccttggcattatgttcaataataatgactctgtttgctctattgttaattatt |
6356410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University