View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_72 (Length: 299)
Name: NF17793_low_72
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 285
Target Start/End: Complemental strand, 39794634 - 39794365
Alignment:
| Q |
16 |
gtatatacatggtaaccggttacactctttatagagggcctgaaaacaatgtttagggacaggtaaccggttaccagttagatagcttgcccataaaatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794634 |
gtatatacatggtaaccggttacactctttatagagggccttaaaacaatgttttgggacaggtaaccggttaccagttagatagcttgcccataaaatg |
39794535 |
T |
|
| Q |
116 |
actttttacttggtaactggttacaccggttgtccattggcaaaactccaaatttccttatgtaaaatgtgtgttaggttattgtgtaatgacaatcgtt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794534 |
actttttacttggtaaccggttacaccggttgttcattggcaaaactccaaatttccttatgtaaaatgtgtgttaggttattgtgtaatgacaatcgtt |
39794435 |
T |
|
| Q |
216 |
tgttatgtatttttcacttaaaagtgacaaaacaaagctaaatgacatcgcattaatacgagagaataat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794434 |
tgttatgtatttttcacttaaaagtgacaaaacaaagctaaatgacatcgcattaatacgagagaataat |
39794365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University