View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_77 (Length: 281)
Name: NF17793_low_77
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 49461827 - 49461606
Alignment:
| Q |
1 |
gcagtttcaacaagatttattgtgttttagcatagttgtcattctatgtgggaagaaggtatgtagaggtctgagtttcttggttcatgtaaaattctct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461827 |
gcagtttcaacaagatttgttgtgttttagcatagttgtcattctatgtgggaagaaggtatgtagaggtctgagtttcttggttcatgtaaaattctct |
49461728 |
T |
 |
| Q |
101 |
aaatttgtaaagaaaatggtaatgattgaaagatcaatggcttatataaaaatatgatcggtgtgttcccaagtcatagttcaactagcaaatgttgaaa |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461727 |
aaatttgtaaagaaaattgtaatgattgaaagatcaatggcttgtatgaaaatatgatcggtgtgttcccaagtcatagttcaactagcaaatgttgaaa |
49461628 |
T |
 |
| Q |
201 |
ttgttagactggataccgtgac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49461627 |
ttgttagactggataccgtgac |
49461606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 43 - 186
Target Start/End: Complemental strand, 42175868 - 42175728
Alignment:
| Q |
43 |
tctatgtgggaagaaggtatgtagaggtctgagtttcttggttcatgtaaaattctctaaatttgtaaagaaaatggtaatgattgaaagatcaatggct |
142 |
Q |
| |
|
||||||||||||||||||||||| || || | ||||| | ||| ||||||||||||||||||| ||||||||| ||||||||||||| ||||| || |
|
|
| T |
42175868 |
tctatgtgggaagaaggtatgtaaag-tcggggtttcctcgtttttgtaaaattctctaaattt--aaagaaaattgtaatgattgaaaaatcaagaact |
42175772 |
T |
 |
| Q |
143 |
tatataaaaatatgatcggtgtgttcccaagtcatagttcaact |
186 |
Q |
| |
|
||||||||||| |||||| || ||| ||| || |||||||||| |
|
|
| T |
42175771 |
tatataaaaatgtgatcgttgctttcacaaatcctagttcaact |
42175728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 11011980 - 11012024
Alignment:
| Q |
170 |
caagtcatagttcaactagcaaatgttgaaattgttagactggat |
214 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
11011980 |
caagtcctagctcaactagcaaatgctgaaattgttaggctggat |
11012024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University