View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_88 (Length: 259)
Name: NF17793_low_88
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 15538589 - 15538696
Alignment:
| Q |
18 |
aatctcccttttcaaattgaaatcataatgcaaagggaagttaaggaaagagtaaggaaaacattgagttttgagagatgtcactgaaattatttacaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15538589 |
aatctcccttttcaaattgaaatcataatgcaaagggaagttaaggaaagagtaaggaaaacattgagttttgagagatgtcactgaaattatttacaca |
15538688 |
T |
 |
| Q |
118 |
ctacttat |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
15538689 |
ctacttat |
15538696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 15527807 - 15527917
Alignment:
| Q |
18 |
aatctcccttttcaaattgaaatcataatgcaaagggaagttaaggaaagagtaaggaaaacattgagttttgagagatgtc----actgaaattattta |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||| ||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
15527807 |
aatcttccttttcaaattgaaatcataatgcaaagggaaattaagggaagagtaagg-aaatattgagttttgaaagatgtcgctggctgaaattattta |
15527905 |
T |
 |
| Q |
114 |
cacactacttat |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15527906 |
cacactacttat |
15527917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 187 - 247
Target Start/End: Original strand, 15538757 - 15538817
Alignment:
| Q |
187 |
tggtgtagaaaaatggtataccccctcagcaaaaagaaatgcaagtactgaccattattat |
247 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15538757 |
tggtgtagaaaaatggtatatcccttcagcaaaaagaaatgcaagtaccgaccattattat |
15538817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 188 - 247
Target Start/End: Original strand, 15527980 - 15528039
Alignment:
| Q |
188 |
ggtgtagaaaaatggtataccccctcagcaaaaagaaatgcaagtactgaccattattat |
247 |
Q |
| |
|
|||||||||||||||| || ||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
15527980 |
ggtgtagaaaaatggtgtatccctttagcaaaaagaaatgcaagtaccgaccattattat |
15528039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University