View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17793_low_91 (Length: 253)

Name: NF17793_low_91
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17793_low_91
NF17793_low_91
[»] chr3 (2 HSPs)
chr3 (120-238)||(32273027-32273145)
chr3 (1-45)||(32272908-32272952)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 120 - 238
Target Start/End: Original strand, 32273027 - 32273145
Alignment:
120 ggtcccgtcataatagaccctgtaccnnnnnnnggaacgccattgaccatttgtttgataaaatcattgaaatagtatcttttaataatctcatataatt 219  Q
    ||||||||||||||||||||||||||       ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32273027 ggtcccgtcataatagaccctgtaccaaaaaaaggaactccattgaccatttgtttgataaaatcattgaaatagtatcttttaataatctcatataatt 32273126  T
220 atgagctctagggcctttg 238  Q
    ||||||||||||| |||||    
32273127 atgagctctagggtctttg 32273145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 32272908 - 32272952
Alignment:
1 ttttttaatatctatatagaaaaatgatagctttttctatgattc 45  Q
    ||||||||||||||| |||||||||||||||||||||||||||||    
32272908 ttttttaatatctatttagaaaaatgatagctttttctatgattc 32272952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University