View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_94 (Length: 250)
Name: NF17793_low_94
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_94 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 46588891 - 46588683
Alignment:
| Q |
1 |
tgtcaatctctatttctctatgtgacggatattgtcaatctctaattatttatatgacggataaaatttgatataaaatgcaaggaacattcacttttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
46588891 |
tgtcaatctctatttctctatgtgacggatattgtcaatctctaattatctatgtgatggataaaattcgatataaaatgcaaagaacactcacttttaa |
46588792 |
T |
 |
| Q |
101 |
acactcattcataaaaatgattcaattatttaaattgaaaaagatatagattatttgtttaattataaataaatttcacttcttaaaataccgttgaatt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46588791 |
acactcatccataaaaatgattcaattatttaaattgaaaaagatatagattgtttgtttaattataaataaatttcacttcttaaaataccgttgaatt |
46588692 |
T |
 |
| Q |
201 |
caatttttt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
46588691 |
caatttttt |
46588683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University