View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17793_low_98 (Length: 241)
Name: NF17793_low_98
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17793_low_98 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 34 - 236
Target Start/End: Complemental strand, 10598563 - 10598361
Alignment:
| Q |
34 |
atcattatgatatctagatcatttgcttcttgattcccatgatcagaaatttcaagaggtggtaacttagagtcaattccaattcctgattcttctgtgt |
133 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598563 |
atcattatgatatctagatcattcgcttcttgattcccatgatcagaaatttcaagaggtggtaacttagagtcaattccaattcctgattcttctgtgt |
10598464 |
T |
|
| Q |
134 |
ctattggtgtatctgctatgtgtccatcatcttctttctggaactcaatcttcacccaaccatctgattcctcactagacttaacatcttcattttattc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
10598463 |
ctattggtgtatctgctatgtgtccatcatcttctttctggaactcaatctttacccaaccatctgattcctcactagacttaacatcttctttttcttc |
10598364 |
T |
|
| Q |
234 |
gac |
236 |
Q |
| |
|
||| |
|
|
| T |
10598363 |
gac |
10598361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University