View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_high_30 (Length: 349)
Name: NF17795_high_30
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_high_30 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 348
Target Start/End: Original strand, 14502 - 14832
Alignment:
| Q |
18 |
agaagcacttatttaatttgcaaaaacaagagatgtatggtccacattctatagtaaagttggcaatgagaagagagcattccatttactgcaatgaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14502 |
agaagcacttatttaatttgcaaaaacaagagatgtatggtccacattctatagtaaagttggcaatgagaagagagcattccatttactgcaatgaatg |
14601 |
T |
|
| Q |
118 |
accctattggacacttgccatagtttcaatgactctcccacccacctctttcctaaattatgaagttatagcgactagtctttcaacatattggcattat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14602 |
accctattggacacttgccatagtttcaatgactctcccacccacctctttcctaaattatgaagttatagcgactagtctttcaacatattggcattat |
14701 |
T |
|
| Q |
218 |
ctgttgctttcttgaaaaattgtgtccagtggaaagctactgaactttggctactgacataactttgaaagcacaaacatggattataaggacataacgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14702 |
ctgttgctttcttgaaaaattgtgtccagtggaaagctactgaactttggctactgacataactttgaaagcacaaacatggattataaggacataacgg |
14801 |
T |
|
| Q |
318 |
aacagtatatcttatacatgatgatgtccat |
348 |
Q |
| |
|
||||||||||||||||||||| |||| |||| |
|
|
| T |
14802 |
aacagtatatcttatacatgaggatgaccat |
14832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University