View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17795_high_35 (Length: 308)

Name: NF17795_high_35
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17795_high_35
NF17795_high_35
[»] chr8 (1 HSPs)
chr8 (200-277)||(37974664-37974741)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 200 - 277
Target Start/End: Complemental strand, 37974741 - 37974664
Alignment:
200 gacaagatcatatttaatttaatcaacctcatacatgataataaattttggtttgtgcaattggagcaacaatgtaaa 277  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37974741 gacaagatcgtatttaatttaatcaacctcatacatgataataaattttggtttgtgcaattggagcaacaatgtaaa 37974664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University