View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_high_47 (Length: 272)
Name: NF17795_high_47
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 35 - 264
Target Start/End: Complemental strand, 40877624 - 40877395
Alignment:
| Q |
35 |
tgaattggtactgtaaattaataaacataactactttggttatgattagtggtgaaaaccaagcatataattaatgtgtagtaagtagacaatgcacgtg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40877624 |
tgaattggtactgtaaattaataaacataactactttggttatgattagtggtgaaaaccaagcatataattaatgtgtagtaagtagacaatgcacgtg |
40877525 |
T |
 |
| Q |
135 |
gaaagattaatttgaagatgggttggtatatttggtaaacccaatccacacaaacaaacactatattttatacttgaggtagaaagaagtagatgggcgt |
234 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40877524 |
gaaagattcatttgaagatgggttggtatatttggtaaacccaatccacacaaacaaacactatattttatacttgaggtagaaagaagtagatgggcgt |
40877425 |
T |
 |
| Q |
235 |
attcaaggctctaaaatggtatcctatgct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40877424 |
attcaaggctctaaaatggtatcctatgct |
40877395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University