View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_high_55 (Length: 238)
Name: NF17795_high_55
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 5898046 - 5897838
Alignment:
| Q |
11 |
gtgaagaagaagagaactatacgtgttcagttgctgatcaagaatcaaggaaaagaactaaattgtacttatccatataacgtggctgcctcatatatag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5898046 |
gtgaagaagaagagaactatacgtgttcagttgctgatcaagaatcaaggaaaagaactaaattgtactcatccatataacgtggctgcctcatatatag |
5897947 |
T |
|
| Q |
111 |
aattaatgaagcatgaattccatgccaatgagagattttcaggnnnnnnnggcaccattaccaagttagattgtgaattttgttccttttcaacaagtgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5897946 |
aattaatgaagcatgaattccatgccaatgagagattttcagg-aaaaaaggcaccattaccaagttagattgtgaaatttgttccttttcaacaagtgc |
5897848 |
T |
|
| Q |
211 |
ttatatatgc |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
5897847 |
ttatatatgc |
5897838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University