View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_high_59 (Length: 228)
Name: NF17795_high_59
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 3 - 211
Target Start/End: Complemental strand, 28717960 - 28717752
Alignment:
| Q |
3 |
atatgtttatagttaaagggtgaaggtgaaagcaaggtatatttttcattatttctgtcgtctaaatacactaaagaccccaaaggccaatgacacccaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28717960 |
atatgtttatagttaaagggtgaaggtgaaagcaaggtatatttttcattatttctgtcgtctaaatacactaaagaccccaaaggccaatgacacccaa |
28717861 |
T |
 |
| Q |
103 |
gtgaaatccgaaatagtggtattacttacaagtttatagggagattttggtgactggactccattagctgaactcattgaaatctgtactcaaattgcat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28717860 |
gtgaaatccgaaatagtggtattacttaccagtttatagggagattttggtgactggactccattagctgaactcattgaaatctgtactcaaattgcat |
28717761 |
T |
 |
| Q |
203 |
gtaccatct |
211 |
Q |
| |
|
||||||||| |
|
|
| T |
28717760 |
gtaccatct |
28717752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University