View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_high_62 (Length: 221)
Name: NF17795_high_62
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_high_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 34496630 - 34496845
Alignment:
| Q |
1 |
atgtttcatcaatgccaagctgaagcagatatcaaatttctgttcttccaccctaagagcattgccccatctttctcaactagtgtatagtgctctgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34496630 |
atgtttcatcaatgccaagctgaagcagatatcaaatttctgctcttccaccctaagagcattgccccatctttctcaactagtgtatagtgctctgaat |
34496729 |
T |
 |
| Q |
101 |
agcatctcagaaggcttcttataacagaattcacataagaactcaaaggacattgacgaaatccggccattgtcaacctagacttccacttaccaaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34496730 |
agcatctcagaaggcttcttataacagaattcacataagaactcaaaggacattgacgaaatccggccattgtcaacctagacttccacttaccaaacag |
34496829 |
T |
 |
| Q |
201 |
ttcatctcactcgacc |
216 |
Q |
| |
|
||| | || ||||||| |
|
|
| T |
34496830 |
ttcgtgtcgctcgacc |
34496845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University