View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_low_39 (Length: 298)
Name: NF17795_low_39
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 87 - 281
Target Start/End: Original strand, 39307300 - 39307494
Alignment:
| Q |
87 |
cttgctagcatgatttaagagacttactatttaaccaaaataaatgtgcaaccaaacaaaataaaagatgcagtcactgatttaacttcaaccatttgca |
186 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39307300 |
cttgctagcttgatttaagagacttactatttaaccaaaataaatgtgcaaccaaacaaaataaaagatgcagtcactgatttaacttcaaccatttcca |
39307399 |
T |
 |
| Q |
187 |
agtatggttgaaatctttgtcatgatggatcttcaaccttcagccttaacaaaatgattcctaatgccaaccagcagtctttctattctcctacc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307400 |
agtatggttgaaatctttgtcatgatggatcttcaaccttcagccttaacaaaatggttcctaatgccaaccagcagtctttctattctcctacc |
39307494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 39307221 - 39307269
Alignment:
| Q |
1 |
tttttagctacgac--tttcaacgataaaatttaatgatacatgcatgc |
47 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39307221 |
tttttagctacgacaatttcaacgataaaatttaatgatacatgcatgc |
39307269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University