View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_low_41 (Length: 294)
Name: NF17795_low_41
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_low_41 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 14 - 294
Target Start/End: Complemental strand, 34497090 - 34496810
Alignment:
| Q |
14 |
agggatggacttttgagattggtgaagtctctctctcctaaagtggtcacccttgtggagcaagaatcaaacacaaacacaacacctttcttcaacaggt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34497090 |
agggatggacttttgagattggtgaagtctctctctcctaaagtggtcacccttgtggagcaagaatcaaacacaaacacaacacctttcttcaacaggt |
34496991 |
T |
 |
| Q |
114 |
tcatagaaactctagactactacttggcaatcttcgagtccatcgatgtcaccctctcaagaaatagcaaggagaggattaatgtggagcaacattgttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34496990 |
tcatagaaactctagactactacttggcaatcttcgagtccatcgatgtcaccctctcaagaaatagcaaggagaggattaatgtggagcaacattgttt |
34496891 |
T |
 |
| Q |
214 |
ggctcgggatatcgtcaatgtcattgcgtgtgaaggaaaagaaagggtcgagcgacacgaactgtttggtaagtggaagtc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34496890 |
ggctcgggatatcgtcaatgtcattgcgtgtgaaggaaaagaaagggtcgagcgacacgaactgtttggtaagtggaagtc |
34496810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University