View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17795_low_55 (Length: 250)
Name: NF17795_low_55
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17795_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 36936421 - 36936666
Alignment:
| Q |
1 |
aaaggataaaggaagtgttggatcctttatatctgaaattacgggtagagcttgttgtttacaagtagatgaggggaccaagaggaatggatcttctgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36936421 |
aaaggataaaggaagtgttggatcctttatatctgaaattacgggtagagcttgttgtttacaagtagatgaggggaccaagaggaatggatcttctgat |
36936520 |
T |
|
| Q |
101 |
ctgtagtccaattaaattttcaagataatggcacttttatggttgaagagtccacatgcatgcagaaatagcaggttaacgcactaaaaggaaacctcct |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36936521 |
ctgtagtccaattaaactttcaagataatggcacttttatggttgaagagtccacatgcatgcagaaatagcaggttaacgcactaaaaggaaacctcct |
36936620 |
T |
|
| Q |
201 |
cgatgtagattgttcatgttatattgattgcactttcttttcagtc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36936621 |
tgatgtagattgttcatgttatattgattgcactttctttttagtc |
36936666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 17 - 82
Target Start/End: Original strand, 992835 - 992900
Alignment:
| Q |
17 |
gttggatcctttatatctgaaattacgggtagagcttgttgtttacaagtagatgaggggaccaag |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
992835 |
gttggatcctttatatctgaaattacgggtagagcttgttgtttacaagtagatgaggggaccaag |
992900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University