View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17796_high_33 (Length: 250)
Name: NF17796_high_33
Description: NF17796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17796_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 96 - 196
Target Start/End: Complemental strand, 24158760 - 24158660
Alignment:
| Q |
96 |
tgctctatcttcacaaattcataggttatattacaaaagtaacaaaacggctaggctatcatgttgccgaatttcttgaccataaatgtggtgtgaatac |
195 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24158760 |
tgctctttcttcacaaattcataggttatattacaaaagtaacaaaacggctaggctatcatgttgccgaatttcttgaccataaatgtggtgtgaatac |
24158661 |
T |
 |
| Q |
196 |
a |
196 |
Q |
| |
|
| |
|
|
| T |
24158660 |
a |
24158660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 24158859 - 24158806
Alignment:
| Q |
1 |
acacttaaaatcgataaagtgctaatttctaatcacacttaaacattacatgtg |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24158859 |
acacttaaaatcgataaagtgctaatttctaatcacacttaaacattacatgtg |
24158806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University