View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17796_low_35 (Length: 255)
Name: NF17796_low_35
Description: NF17796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17796_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 38609537 - 38609299
Alignment:
| Q |
1 |
taacttgtttgtcatattaccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaaaatgggcatgg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609537 |
taacttgtttgtcactataccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaaaatgggcatgg |
38609438 |
T |
 |
| Q |
101 |
gcttggtcaggtgagtcgtggaggatcctctgctacttcaa-nnnnnnnnnattattgt-aaccgtgcctatgatatctctctatcgtctctttgtaaag |
198 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609437 |
gcttggtcaggtgagtcatggaggatcatctgctacttcaattttttttttattattgtcaaccgtgcctatgatatctctctatcgtctctttgtaaag |
38609338 |
T |
 |
| Q |
199 |
cttgtttgcattgtgtttattgcaaatataagttctatg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609337 |
cttgtttgcattgtgtttattgcaaatataagttctatg |
38609299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 38609303 - 38609238
Alignment:
| Q |
167 |
ctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609303 |
ctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
38609238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 229
Target Start/End: Complemental strand, 38604270 - 38604205
Alignment:
| Q |
164 |
tgcctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataa |
229 |
Q |
| |
|
|||||||||| |||||||||| ||||| ||| || |||||||||||| |||| |||||| |||||| |
|
|
| T |
38604270 |
tgcctatgatgtctctctatcctctctctgtgaaacttgtttgcattttgttaattgcagatataa |
38604205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University