View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17796_low_36 (Length: 250)

Name: NF17796_low_36
Description: NF17796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17796_low_36
NF17796_low_36
[»] chr5 (2 HSPs)
chr5 (96-196)||(24158660-24158760)
chr5 (1-54)||(24158806-24158859)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 96 - 196
Target Start/End: Complemental strand, 24158760 - 24158660
Alignment:
96 tgctctatcttcacaaattcataggttatattacaaaagtaacaaaacggctaggctatcatgttgccgaatttcttgaccataaatgtggtgtgaatac 195  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24158760 tgctctttcttcacaaattcataggttatattacaaaagtaacaaaacggctaggctatcatgttgccgaatttcttgaccataaatgtggtgtgaatac 24158661  T
196 a 196  Q
    |    
24158660 a 24158660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 24158859 - 24158806
Alignment:
1 acacttaaaatcgataaagtgctaatttctaatcacacttaaacattacatgtg 54  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24158859 acacttaaaatcgataaagtgctaatttctaatcacacttaaacattacatgtg 24158806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University