View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17796_low_45 (Length: 212)
Name: NF17796_low_45
Description: NF17796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17796_low_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 33338124 - 33338305
Alignment:
| Q |
18 |
aaaaattagcttatgtcagcaatttcttgatatagtatcctataaaa-caagcattttcttgatagtgtaccttaatatattttaacaagtgcttgtcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
33338124 |
aaaaattagcttatgtcagcaatttcttgatattatatcctataaaaacaagcattttcttgatagtgcaccttaatatattttaacaagtgcttggcaa |
33338223 |
T |
 |
| Q |
117 |
cgtgatgggatcaattttaacacattatatgtgatttataat-aaaaaactagttttttaatagttttatatattgtctctg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338224 |
cgtgatgggatcaattttaacacattatatgtgatttataataaaaaaactagttttttaatagttttatatattgtctctg |
33338305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 61 - 194
Target Start/End: Complemental strand, 35127915 - 35127777
Alignment:
| Q |
61 |
aaaacaagcattttcttgatagtgtaccttaatatattttaacaagtgcttgtcaacgtgatgggatcaattttaacacattatatgtgatttataataa |
160 |
Q |
| |
|
|||||||| | |||||||||||| ||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35127915 |
aaaacaagaaatttcttgatagtacacccaaatatattttaactagtgcttgtcaacgtgatggcatcaattttaacacattatatgtgattgataataa |
35127816 |
T |
 |
| Q |
161 |
aaaac---tagttt--tttaatagttttatatattgtct |
194 |
Q |
| |
|
|||| |||||| |||||||||||||||| |||||| |
|
|
| T |
35127815 |
aaaaaaattagtttgttttaatagttttatatcttgtct |
35127777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University