View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17797_high_40 (Length: 220)
Name: NF17797_high_40
Description: NF17797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17797_high_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 91 - 220
Target Start/End: Original strand, 25254532 - 25254661
Alignment:
| Q |
91 |
tacatatatttcataaaggaagcatttatgtgaaggtaataatttttatttatgaggattctaaccttactaagccatatgcaaaaccaaactgttccta |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25254532 |
tacatatatttcgtaaaggaagcatttatgtgaaggtaataatttttatgtatgcgaattctaaccttactaagccatatacaaaaccaaactgttccta |
25254631 |
T |
 |
| Q |
191 |
gagaaccaaaggagtaaaacaccgatggcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25254632 |
gagaaccaaaggagtaaaacaccgatggcc |
25254661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University