View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17797_high_42 (Length: 202)
Name: NF17797_high_42
Description: NF17797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17797_high_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 9e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 14 - 182
Target Start/End: Complemental strand, 21706068 - 21705900
Alignment:
| Q |
14 |
aaattgtgaaggaaatggagtttgagtactttcagttgaggaagcatgatgtggttgtggtatttgtgagaagaatgatgttcatgatcacattcaccaa |
113 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21706068 |
aaattgtgaaggaattcgagattgagtactttcagttgaggaagcatgatgtggttgtggtatttgtgagaagaatgatgttcatgatcacattcaccaa |
21705969 |
T |
|
| Q |
114 |
atatatatttcagctcaggaacttttcttatatatatcgattgcagccgtgaaagtccttccacataac |
182 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21705968 |
atatatatttcagctcaggaacgcctattatatatatcgattgtagccgtgaaagtccttccacataac |
21705900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 31 - 180
Target Start/End: Original strand, 21713480 - 21713629
Alignment:
| Q |
31 |
gagtttgagtactttcagttgaggaagcatgatgtggttgtggtatttgtgagaagaatgatgttcatgatcacattcaccaaatatatatttcagctca |
130 |
Q |
| |
|
||||||||| |||| |||||||| ||||||| ||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21713480 |
gagtttgagaacttccagttgagaaagcatggtgtggttcaggtattggtgagatgaatgatgttcatgatcacattcaccaaatatatatttcagctca |
21713579 |
T |
|
| Q |
131 |
ggaacttttcttatatatatcgattgcagccgtgaaagtccttccacata |
180 |
Q |
| |
|
|| ||||| ||||| |||| || |||| || ||||||||| ||||| |
|
|
| T |
21713580 |
tgaccttttgctatatgtatccgtttcagctctgcaagtccttcgacata |
21713629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University