View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17797_low_29 (Length: 324)
Name: NF17797_low_29
Description: NF17797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17797_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 316
Target Start/End: Original strand, 3639948 - 3640246
Alignment:
| Q |
18 |
gttaccgtgttatcggcttgtgcttctatcgggtctttcagtttggggtgttgggtgcatgattatattgagaaaaggattgatcttgatgttgatggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639948 |
gttaccgtgttatcggcttgtgcttctatcgggtctttgagtttggggtgttgggtgcatgattatattgagaaaaggattgatcttgatgttgatggta |
3640047 |
T |
|
| Q |
118 |
atattggaaatgcattggttaacatgtatgttaagtgtggtgatatgaaaatggggttgaaggtttttaacatggttgttcataaagatgttatttcttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640048 |
atattggaaatgcattggttaacatgtatgttaagtgtggtgatatgaaaatggggttgaaggtttttaacatggttgttcataaagatgttatttcttg |
3640147 |
T |
|
| Q |
218 |
gggtactgttatttgtggattggctatgaatgggtatggtaaacaagttgtgcagatgttttcacatatgctggttcatggggttttacctgatgatgt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640148 |
gggtactgttatttgtggattggctatgaatgggtatggtaaacaagttgtgcagatgttttcacatatgctggttcatggggttttacctgatgatgt |
3640246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University