View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17797_low_36 (Length: 280)
Name: NF17797_low_36
Description: NF17797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17797_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 2347547 - 2347294
Alignment:
| Q |
18 |
tttttctattggcttagctctagacatgcttcttaaagcaagtttctatgtgtggccacggtaaaactcaaacaaaatgctaagattcatttaaccaaaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347547 |
tttttctattggcttagatctagacatgcttcttaaagcaagtttctatgtgtggccacggtaaaactcaaacaaaatgctaagattcatttaaccaaaa |
2347448 |
T |
|
| Q |
118 |
taatcaaaatgcagggtaaaaatgatagacaaacttttaagggaacaattgcatcacaacacatcattcacatgacgcgtaccgcaaacccgtaccaaca |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2347447 |
taatcaaaatgcagagtaaaaatgatagacaaacttttaagggaacaattgcatcacaacacatcattcacatgtcgcgtaccgcaaacccgtaccaaca |
2347348 |
T |
|
| Q |
218 |
tgaattgcaaattatgtgactattgttcaactcacttgtataatggctctgtgc |
271 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2347347 |
tgaattgcaaattatgtgactatggttcaactcacttgtataatggctctgtgc |
2347294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 80 - 120
Target Start/End: Original strand, 2489947 - 2489987
Alignment:
| Q |
80 |
aaaactcaaacaaaatgctaagattcatttaaccaaaataa |
120 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
2489947 |
aaaactcaaacaaaatgctaagaatcgtttaaccaaaataa |
2489987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 120
Target Start/End: Complemental strand, 2626507 - 2626459
Alignment:
| Q |
72 |
gccacggtaaaactcaaacaaaatgctaagattcatttaaccaaaataa |
120 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
2626507 |
gccacagtaaaactcaaatgaaatgctaagaatcatttatccaaaataa |
2626459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University