View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17797_low_42 (Length: 247)
Name: NF17797_low_42
Description: NF17797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17797_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 23 - 238
Target Start/End: Original strand, 22619017 - 22619232
Alignment:
| Q |
23 |
tctgtggatttgcgtcgacctgcggagcacaagtgggttcttctggaattggaaagaacgagtggttttgcagaagagagtgaattgatggagctgaaag |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22619017 |
tctgtgggtttgcgtcgacctgcggagcacaagtgggttcttctggaattggaaagaacgagtggttttgcagaagagagtgaattgatggagctgaaag |
22619116 |
T |
|
| Q |
123 |
ggtagtgattgtgaacctgttttggtatgtgccattggagatgatagagtgatgattttgaggcaaaaggtgaatggaacgaacatagcaatgttggaga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
22619117 |
ggtagtgattgtgaacctgttttggtatgtgccattggagatgatagagtgatgattttgaggccaaaggtgaatggaatgaacatagcaatgttggaga |
22619216 |
T |
|
| Q |
223 |
caaagctgatgatgtc |
238 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
22619217 |
caaagctgttgatgtc |
22619232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University