View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17798_high_13 (Length: 233)
Name: NF17798_high_13
Description: NF17798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17798_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 215
Target Start/End: Complemental strand, 6084062 - 6083856
Alignment:
| Q |
9 |
acatcatcagggttaaaatcagtaacacaattttgttccaacaccactctaactacatcctgaaaccaaccaggaatattacccttaaatatgtcattgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6084062 |
acatcatcagggttaaaatcagtaacacaattttgttccaacaccactctaactacatcctgaaaccaaccaggaatattacccttaaatatgtcactgg |
6083963 |
T |
 |
| Q |
109 |
aacatgtttccggattcgatgcagcgaattccgagatatgatcagaatcagacaatggactgatctcatctagtatagtctctgagaagccaattatttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083962 |
aacatgtttccggattcgatgcagcgaattccgagatatgatcagaatcagacaatggactgatctcatctagtatagtctctgagaagccaattatttc |
6083863 |
T |
 |
| Q |
209 |
attattt |
215 |
Q |
| |
|
||||||| |
|
|
| T |
6083862 |
attattt |
6083856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University