View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17798_low_12 (Length: 369)
Name: NF17798_low_12
Description: NF17798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17798_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 36 - 346
Target Start/End: Complemental strand, 40465536 - 40465225
Alignment:
| Q |
36 |
aaaataaaataaagaaaatgactaaacatgctacacaagagttgcttattttaagtgaatttcaaccatacttttgttatctcaatatctaagtttcgca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40465536 |
aaaataaaataaagaaaatgactaaacatgctacacaagagttgcttattttaagtgaatttcaaccatacttttgttatctcaatatctaagtttcgaa |
40465437 |
T |
|
| Q |
136 |
tttgtatttttgtgtgtgattattcattcaagtggg--aactagtggttgcatgannnnnnnnctcttgtagcatttttatgttatagtttaaatttaca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
40465436 |
tttgtatttttgtgtgtgattattcattcaagtgggggaactagtggttgcatgattttttt-ctcttgtagcatttttatgctatagttcaaatttaca |
40465338 |
T |
|
| Q |
234 |
aacttatctatcaatatacacctggcaatctggggttgtttatccttctgaaccattttgtctttctctccatgttccatattacaccctttagattctc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465337 |
aacttatctatcaatatacacctggcaatctggggttgtttatccttctgaaccattttgtctttctctccatgttccatattacaccctttagattctc |
40465238 |
T |
|
| Q |
334 |
attggcattatcc |
346 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40465237 |
attggcattatcc |
40465225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 48
Target Start/End: Complemental strand, 40465569 - 40465534
Alignment:
| Q |
13 |
cattcatatcatatcttcatttcaaaataaaataaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465569 |
cattcatatcatatcttcatttcaaaataaaataaa |
40465534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University