View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17798_low_18 (Length: 268)
Name: NF17798_low_18
Description: NF17798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17798_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 35 - 258
Target Start/End: Complemental strand, 53899931 - 53899709
Alignment:
| Q |
35 |
cgtttataaatgatgagtttgaacaaaagtgcggcagaaatatacgttaacgttgaagacagtatttatagcttatggatatcacggcatagtagtagct |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53899931 |
cgtttataaatgatgagtttgaacaaaagtgcggcagaaatacacgttaacgttgaagagagtatttatagcttatggatatcacggcatagtagtagct |
53899832 |
T |
 |
| Q |
135 |
ttttggatatcacggcatatacacatccaaaagcatgcaaacccaaatgggttttgaatgagttgctttaacctaataatatgactctatgtcacactta |
234 |
Q |
| |
|
||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53899831 |
ttt-ggatatcacgtcataaacacatccaaaagcatgcaaacccaaatgggttttgaatgagttgctttaacctaataatatgactctatgtcacactta |
53899733 |
T |
 |
| Q |
235 |
agcaaccttatatttaagttcatc |
258 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53899732 |
agcaaccttatatttaagttcatc |
53899709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University