View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1779_high_10 (Length: 210)
Name: NF1779_high_10
Description: NF1779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1779_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 25431163 - 25431356
Alignment:
| Q |
1 |
ctgacattcaaagtatagtagtgatcttttccacctttggctctgaccactgttgcgaaacgggagcggtttcttgtggatgagagagggaaaggagttg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25431163 |
ctgacattcaaagtagagtagtgatcttttccacctttggctctgaccactgttgcgaaacgggagcggtttcttgtggaggagagagggaaaggagttg |
25431262 |
T |
 |
| Q |
101 |
tggttttgaaggtgaggtttgaaggggtggcaatggtgaaaggggaagaagatggtggtgagagggtgatgaatggcattgaaaatggggtttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25431263 |
tggttttgaaggtgaggtttgaaggggtggcaatggtgaaaggggaagaagatggtggtgagagggtgatgaatggcattgaaaatggggtttg |
25431356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University