View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1779_high_5 (Length: 294)
Name: NF1779_high_5
Description: NF1779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1779_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 73 - 282
Target Start/End: Original strand, 38505941 - 38506150
Alignment:
| Q |
73 |
ggaatcagaagtaactgcattgtgactcgaatgaattagtgtaaagtgtagaagacaacattagaagacgaagcttgtgagttgctataaactctcaaac |
172 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38505941 |
ggaatcaaaagtaacttcattgtgactcgaatgagttagtgtaaagtgtagaagacaacattagaagacgaagcttgtgagttgttataaactctcaaac |
38506040 |
T |
|
| Q |
173 |
agattattacatcaagtatccataatgaattttaagcatgttgaattttttaagtgataagctacttgtagagttcatgctcttacatgagcatctaatt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
38506041 |
agattattacatcaagtatccataatgaattttaagcatgttgaattttttaagtgataagctacttgtagagttcacgctcttacaagagcatctaatt |
38506140 |
T |
|
| Q |
273 |
cttatgcttc |
282 |
Q |
| |
|
|||||||||| |
|
|
| T |
38506141 |
cttatgcttc |
38506150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 54
Target Start/End: Original strand, 38505904 - 38505941
Alignment:
| Q |
17 |
cagtgttgatgctgacatttttcaactcaatagtttgg |
54 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38505904 |
cagtgttgatgctgacatttttctactcaatagtttgg |
38505941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University