View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1779_low_3 (Length: 313)
Name: NF1779_low_3
Description: NF1779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1779_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 22155311 - 22155007
Alignment:
| Q |
1 |
tcatcatctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagctacgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155311 |
tcatcatctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagctacgat |
22155212 |
T |
 |
| Q |
101 |
gccggtccttgtaagggtatgatccatctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatccctg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155211 |
gccggtccttgtaagggtatgatccctctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatccctg |
22155112 |
T |
 |
| Q |
201 |
ctcattttcatcagggtgtggtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgattatct |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155111 |
ctcattttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgattatct |
22155012 |
T |
 |
| Q |
301 |
ctgct |
305 |
Q |
| |
|
||||| |
|
|
| T |
22155011 |
ctgct |
22155007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University