View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17800_high_3 (Length: 239)
Name: NF17800_high_3
Description: NF17800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17800_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 43 - 221
Target Start/End: Complemental strand, 45363896 - 45363717
Alignment:
| Q |
43 |
caaattggatgattcttcctatttttcaatggtgatgttttcctatttcatccaacacagtgctgctgatattttgtttctcttggtctagctattgcta |
142 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45363896 |
caaattggatgattcctcctatttttcaatggtgatgttttcctatttcatccaacacagtgctgctgatattttgtttctcttggtctagctattgcta |
45363797 |
T |
 |
| Q |
143 |
ttaaacaagcttggatgaaggcca-atgtatgtaatcttcagcattttgatatatccattccattcatagacccaacaag |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45363796 |
ttaaacaagcttggatgaaggccacatgtatgtaatcttcagcattttgatatatccattccattcatagacccaacaag |
45363717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University