View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17803_high_10 (Length: 239)
Name: NF17803_high_10
Description: NF17803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17803_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 36568692 - 36568883
Alignment:
| Q |
13 |
tgcttctgcttctgcttcccttttctgtcaataactttcttccttgatttgaaccattaacggttctctgatgcttggatagaaagaggaaaagattgtt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568692 |
tgctactgcttctgcttcccttttctgtcaataactttcttccttgatttgaaccattaacgattctctgatgcttggatagaaagaggaaaagattgtt |
36568791 |
T |
 |
| Q |
113 |
tgttaaactatgatgtacttacctgtcttcctctttcatttctttctttttgaagaagttatgattattagtctaaagtttttcacttctgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568792 |
tgttaaactatgatgtacttacctgtcttcctctttcatttctttctttttgaagaagttatgattattagtctaaagtttttcacttctgc |
36568883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University