View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17803_high_13 (Length: 201)
Name: NF17803_high_13
Description: NF17803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17803_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 183
Target Start/End: Original strand, 4235600 - 4235773
Alignment:
| Q |
10 |
gaagaatatagagaagaagaacgggttgtacggtattttaaacaaaagatggtacccttttcaatttcaggtatgccatgctaataaccctaaactttcg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235600 |
gaagaatatagagaagaagaacgggttgtacggtattctaaacaaaagatggtacccttttcaatttcaggtatgccatgctaataaccctaaactttcg |
4235699 |
T |
 |
| Q |
110 |
ctttgtggctctagccatggttggtttgcattagtagatgattctaagtccattataaccctaatgagtccttt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235700 |
ctttgtggctctagccatggttggtttgcattagtagatgattctaagtccattataaccctaatgagtccttt |
4235773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 24 - 183
Target Start/End: Original strand, 49145180 - 49145339
Alignment:
| Q |
24 |
agaagaacgggttgtacggtattttaaacaaaagatggtacccttttcaatttcaggtatgccatgctaataaccctaaactttcgctttgtggctctag |
123 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
49145180 |
agaagaattggttgtatggtattctaaacaaaagatggcacccttttcaatttcagttatgccatgctaataatagtaaactttcgctctgtggctctag |
49145279 |
T |
 |
| Q |
124 |
ccatggttggtttgcattagtagatgattctaagtccattataaccctaatgagtccttt |
183 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49145280 |
ccatggttggtttgcatttgtagatgattccaagtccattataaccctaatgagtccttt |
49145339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 113 - 159
Target Start/End: Original strand, 49149784 - 49149830
Alignment:
| Q |
113 |
tgtggctctagccatggttggtttgcattagtagatgattctaagtc |
159 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
49149784 |
tgtggctctagccatggttggcttgcattagtagattattctaagtc |
49149830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University