View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17803_low_4 (Length: 427)

Name: NF17803_low_4
Description: NF17803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17803_low_4
NF17803_low_4
[»] chr3 (2 HSPs)
chr3 (252-377)||(39508391-39508516)
chr3 (69-103)||(39508666-39508700)
[»] chr4 (1 HSPs)
chr4 (382-411)||(17062570-17062599)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 5e-60; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 252 - 377
Target Start/End: Complemental strand, 39508516 - 39508391
Alignment:
252 cttcctcttttcgtatttgcgttggtgtattctaattatatctctttttacatcttaatatgtgatgctttatttttcttttcttcgttaaagtttttga 351  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39508516 cttcctcttttcgtatttgcgttggtgtattctaattatatccctttttacatcttaatatgtgatgctttatttttcttttcttcgttaaagtttttga 39508417  T
352 atcagttcatcaaatgcttgataatt 377  Q
    |||||| |||||||||||||||||||    
39508416 atcagtgcatcaaatgcttgataatt 39508391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 69 - 103
Target Start/End: Complemental strand, 39508700 - 39508666
Alignment:
69 caatctgcatgtatgagtgtagtatcctagctata 103  Q
    |||||||||||||||||||||||||||||||||||    
39508700 caatctgcatgtatgagtgtagtatcctagctata 39508666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 382 - 411
Target Start/End: Complemental strand, 17062599 - 17062570
Alignment:
382 ggtgccatctagcctacccaagggcatatt 411  Q
    ||||||||||||||||||||||||||||||    
17062599 ggtgccatctagcctacccaagggcatatt 17062570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University