View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17803_low_4 (Length: 427)
Name: NF17803_low_4
Description: NF17803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17803_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 5e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 252 - 377
Target Start/End: Complemental strand, 39508516 - 39508391
Alignment:
| Q |
252 |
cttcctcttttcgtatttgcgttggtgtattctaattatatctctttttacatcttaatatgtgatgctttatttttcttttcttcgttaaagtttttga |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39508516 |
cttcctcttttcgtatttgcgttggtgtattctaattatatccctttttacatcttaatatgtgatgctttatttttcttttcttcgttaaagtttttga |
39508417 |
T |
 |
| Q |
352 |
atcagttcatcaaatgcttgataatt |
377 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
39508416 |
atcagtgcatcaaatgcttgataatt |
39508391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 69 - 103
Target Start/End: Complemental strand, 39508700 - 39508666
Alignment:
| Q |
69 |
caatctgcatgtatgagtgtagtatcctagctata |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39508700 |
caatctgcatgtatgagtgtagtatcctagctata |
39508666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 382 - 411
Target Start/End: Complemental strand, 17062599 - 17062570
Alignment:
| Q |
382 |
ggtgccatctagcctacccaagggcatatt |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17062599 |
ggtgccatctagcctacccaagggcatatt |
17062570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University