View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17803_low_7 (Length: 316)
Name: NF17803_low_7
Description: NF17803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17803_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 54038290 - 54037990
Alignment:
| Q |
1 |
catttttatgcgcccaaaatatttaaaccgagttacttgtggtattgtactccatatgcaacttttacatctaatttaaccttttccatttgtataactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54038290 |
catttttatgcgcccaaaatatttaaaccgagttacttgtggtattgtactccatatgcaacttttacatctaatttaaccttttccatttgtataactt |
54038191 |
T |
|
| Q |
101 |
acatagcacatattttgtcttgcatatatacaacttttccatatcaactaaaatcatctgcaaatttcttcattcttcgttatcaatacatcactcggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54038190 |
acatagcacatattttgtcttgcatatatacaacttttccatatcaactaaaattatctgcaaatttcttcattcttcgttatcaatacatcactcggga |
54038091 |
T |
|
| Q |
201 |
tagcaagtaaaatatttccatgattaccttccgaacataaaaccaaatttgcctagagctgaataaatcaagataaggatttgacgtgagttttatctgc |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54038090 |
tagcaagtaaaat-tttccatgattaccttccgaacataaaaccaaatttgcctagagctgaat-aatcaagataaggatttgaggtgagttttatctgc |
54037993 |
T |
|
| Q |
301 |
cct |
303 |
Q |
| |
|
||| |
|
|
| T |
54037992 |
cct |
54037990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University