View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17804_high_15 (Length: 332)
Name: NF17804_high_15
Description: NF17804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17804_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 21 - 329
Target Start/End: Original strand, 29958509 - 29958817
Alignment:
| Q |
21 |
acatcatcaataaggaatgcatcaaggttcttgatggaggaatccacccttgcagaactgttcatttgcaacatctggttaaataatgtttttgcagcct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958509 |
acatcatcaataaggaatgcatcaaggttcttgatggaggaatccacccttgcagaactgttcatttgcaacatctggttaaataatgtttttgcagcct |
29958608 |
T |
 |
| Q |
121 |
cattaatcgaaggctggtacttaacaacacgtccatcaagaggattatggggattcttggtgtctaaactatcttcttcctgcccctggagccgcctctt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958609 |
cattaatcgaaggctggtacttaacaacacgcccatcaagaggattatggggattcttggtggctaaactatcttcttcctgcccctggagccgcctctt |
29958708 |
T |
 |
| Q |
221 |
tttacctgcggtaacatgtctattactttcattctgctgctgtgaaaattgagccataaagcccggactattcatggcctttgccagaaaggacatcatc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958709 |
tttacctgcggtaacatgtctattactttcattctgctgctgtgaaaattgagccataaagcccggactattcatggcctttgccagaaaggacatcatc |
29958808 |
T |
 |
| Q |
321 |
ttttgctga |
329 |
Q |
| |
|
| ||||||| |
|
|
| T |
29958809 |
tgttgctga |
29958817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University