View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17805_low_21 (Length: 277)
Name: NF17805_low_21
Description: NF17805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17805_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 88 - 276
Target Start/End: Complemental strand, 42004675 - 42004487
Alignment:
| Q |
88 |
tcttaattcattattttctaacaccaattcagaatgggaatgattcaagattcttatgagattaattttaatagttttggtttgtggaaatatgaaaata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42004675 |
tcttaattcattattttctaacaccaattcagaatgggaatgattcaagattcttatgagattaattttaatagttttggtttgtggaaatatgaaaata |
42004576 |
T |
 |
| Q |
188 |
atctaagttgataattttgttcttttgtttgtcttctacaccagattcttgaaaatcttccttggttagaagaatggctacttaatagt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42004575 |
atctaagttgataattttgttcttttgtttgtcttctacaccagattcttgaaaatcttccttggttagaagaatggctacttaatagt |
42004487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 42006624 - 42006554
Alignment:
| Q |
18 |
catggttttaaattgcagttgcgttgagatcctccattttgtagaggtttgcaaccacatgcagcttatgt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006624 |
catggttttaaattgcagttgcgttgagatcctccattttgtagaggtttgcaaccacatgcagcttatgt |
42006554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 167 - 258
Target Start/End: Complemental strand, 42013600 - 42013509
Alignment:
| Q |
167 |
gtttgtggaaatatgaaaataatctaagttgataattttgttcttttgtttgtcttctacaccagattcttgaaaatcttccttggttagaa |
258 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||| ||||||| |||||||||||||||||| | |||||||| ||||||| || |||||||| |
|
|
| T |
42013600 |
gtttgtggaaatatgaacataacctatgttgacaattttgatcttttgtttgtcttctataacagattctaccaaatctttctcggttagaa |
42013509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University