View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17805_low_27 (Length: 234)
Name: NF17805_low_27
Description: NF17805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17805_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 40894917 - 40895121
Alignment:
| Q |
19 |
ataatagtaatagtagatgttcgtttcccacttgtgtgatggcaattatcatatagtaggctagtattaggagtctgaccttaattcactttg----ctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40894917 |
ataatagtaatagtagatgttcgtttcccacttgtatgatggcaattatcatatagtaggctagtattaggagtctgaccttaattcactttgtttgctt |
40895016 |
T |
|
| Q |
115 |
gttatttgtatcttggattcgtaacaagtttggattgttttgcccaataaatgctttttgttcttctttccctcgcttattatgggtatcttgttctttc |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40895017 |
gttatttgtatcttggattcgaaacaagtttggattgttttgcccaataaatgctttttgttcttctttccctcgcttattatgggtatcttgttctttc |
40895116 |
T |
|
| Q |
215 |
ctatg |
219 |
Q |
| |
|
||||| |
|
|
| T |
40895117 |
ctatg |
40895121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 40898100 - 40898035
Alignment:
| Q |
19 |
ataatagtaatagtagatgttcgtttcccacttgtgtgatggcaattatcatatagtaggctagta |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
40898100 |
ataatagtaatagtagatgttcatttcccactcgtgtgatggcaatcatcctatagtaggctagta |
40898035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 44153435 - 44153385
Alignment:
| Q |
33 |
agatgttcgtttcccacttgtgtgatggcaattatcatatagtaggctagt |
83 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
44153435 |
agatgttcatttcccactcgtgtgatggcaatcatcctatagtaggctagt |
44153385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 170
Target Start/End: Complemental strand, 40897975 - 40897927
Alignment:
| Q |
122 |
gtatcttggattcgtaacaagtttggattgttttgcccaataaatgctt |
170 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||| ||||||| |
|
|
| T |
40897975 |
gtatcttggatttgtaacaagtttggattattatgcccaaataatgctt |
40897927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University