View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17805_low_30 (Length: 214)
Name: NF17805_low_30
Description: NF17805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17805_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 13724538 - 13724722
Alignment:
| Q |
14 |
atgaaaatcagcatatttaataaacggaagaaactcaatcttacgattaccaatgcattgactgcgtgaatgatgaaatatccatttaggggtggtgcaa |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13724538 |
atgaaaatcagcatatttagtaaacggaagaaactcaatcttacgattaccaatgcattgactgcgtgaatgccaaaatatccatttaggggtggtgcaa |
13724637 |
T |
|
| Q |
114 |
gttatgtaacttagcataatgtcaattcattcacaaactcaacaatattcttatgagaacttccactctcaccaacagaattcct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
13724638 |
gttatgtaacttagcataatgtcaattcattcacaaactcaacaatattcttatgagaacttccatcctcaccaacagaaatcct |
13724722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 189
Target Start/End: Original strand, 13695329 - 13695383
Alignment:
| Q |
135 |
tcaattcattcacaaactcaacaatattcttatgagaacttccactctcaccaac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||| |||| |
|
|
| T |
13695329 |
tcaattcattcacaaactcaacaatattcttatcagaacttccaccctcatcaac |
13695383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University