View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17806_low_7 (Length: 207)
Name: NF17806_low_7
Description: NF17806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17806_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 86 - 191
Target Start/End: Complemental strand, 43394113 - 43394006
Alignment:
| Q |
86 |
agccatcacccaagtaataatatgatggaattgcaaatgggt--gttatattttctattactactgtcggaacttgctgcaaatgaactacaacggtatg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
43394113 |
agccatcacccaagtaataatatgatggaattgcaaatgggtttgttatattttctattactactgttggaacttgctgcaaatgaactgcaacggtatg |
43394014 |
T |
 |
| Q |
184 |
gagccttt |
191 |
Q |
| |
|
|||||||| |
|
|
| T |
43394013 |
gagccttt |
43394006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University