View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17808_high_11 (Length: 227)
Name: NF17808_high_11
Description: NF17808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17808_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 55455250 - 55455107
Alignment:
| Q |
1 |
caactgaaaatgttttctttttgaaggattgccgtttataaggctatctacccatccgggggaactatggcagatgctgttgcagctattgaacaagtaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55455250 |
caactgaaaatgttgtctttttgaaggattgccgtttataaggctatctacccatccgggggaactatggcagatgctgttgcagctattgaacaagtaa |
55455151 |
T |
|
| Q |
101 |
gtgtcgattctgttctcaaactaattagatgcatcaagcaactc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55455150 |
gtgtcgattctgttctcaaactaattagatgcatcaagcaactc |
55455107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University