View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17808_high_13 (Length: 212)
Name: NF17808_high_13
Description: NF17808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17808_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 25356096 - 25356277
Alignment:
| Q |
13 |
attattcttgatcatttatcatatgtggaagaaattagtttgcatgttattattacgcttttaattgttaattgtttgttggcttctaaagtatttatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25356096 |
attattcttgatcatttatcatatgtggaagaaattagtttgcatgttattattacgcttttaattgttaattgtttgttggcttctaaagtatttatgc |
25356195 |
T |
 |
| Q |
113 |
atacgtttagcgtgtttttggttcacgtaatcatcattgtggatcttaaattagagatggagtctcaactcatgaacaattt |
194 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25356196 |
atatgtttagcgtgtttttggttaacgtaatcatcattgtggatcttaaattagagatggagtctcagctcattaacaattt |
25356277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 194
Target Start/End: Original strand, 25356279 - 25356318
Alignment:
| Q |
155 |
atcttaaattagagatggagtctcaactcatgaacaattt |
194 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25356279 |
atcttaaattaaagatggagtctcaactcatgaacaattt |
25356318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 3135576 - 3135536
Alignment:
| Q |
14 |
ttattcttgatcatttatcatatgtggaagaaattagtttg |
54 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
3135576 |
ttatttttgatcatttatcatatgtgaaagaatttagtttg |
3135536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University