View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17808_low_12 (Length: 213)
Name: NF17808_low_12
Description: NF17808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17808_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 11319018 - 11318824
Alignment:
| Q |
15 |
tataaataaaaagaactacataaaaaattttatccaataaannnnnnnnnataaatcatacatatttttcaagagactaattagacagcacaaacggtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11319018 |
tataaataaaaagaactacataaaaaattt-atccaatagataaaattttataaatcatacatatttttcaagagattaattagacagcacaaacggtca |
11318920 |
T |
 |
| Q |
115 |
atgtctccaaaatttgacatgtaagatcaaaatcaaatgaatttatttcat-------------tatttcacatgtaatatttataagatattaat |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11318919 |
atgtctccaaagtttgacatgtaagatcaaaatcaaatgaatttatttcataactaaatatacatatttcacatgtaatatttataagatattaat |
11318824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University