View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17808_low_7 (Length: 248)
Name: NF17808_low_7
Description: NF17808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17808_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 55455433 - 55455654
Alignment:
| Q |
1 |
ttaaatcactcactaaatcggtggtaacattagcggctaatgatttagcgattttttgccaattgatagctaaatcagccacaaacttatatagctcgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||| |
|
|
| T |
55455433 |
ttaaatcactcactaaatcggtggtaacattagcgactaatgatttagcgattttttgccaattgatatctaaatcagtcacaaacttatatagcttgcc |
55455532 |
T |
|
| Q |
101 |
aaatggtaaaccttcagttgtgtaagctagtaaagattgcttggataagggggaaatgacggaaaagagaggtataagttctcgaatatgtcacactaag |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55455533 |
aaatggtaaaccttcagttgtgtgagctagtaaagattgcttggataagggggaaatggcggaaaagagaggtataagttttcgaatatgtcacactaag |
55455632 |
T |
|
| Q |
201 |
gaaactactttaatcagaatag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55455633 |
gaaactactttaatcagaatag |
55455654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University