View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17808_low_9 (Length: 242)
Name: NF17808_low_9
Description: NF17808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17808_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 14 - 137
Target Start/End: Complemental strand, 38712235 - 38712112
Alignment:
| Q |
14 |
ttcttctgtctttctacttcaagtttggaaagccttacttcccccaactctagtttttatttttaggacatgtgcatggttccaatataacattaaccaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712235 |
ttcttctgtctttctacttcaagtttggaaagccctacttcccccaactctagtttttatttttaggacatgtgcatggttccaatataacattaaccaa |
38712136 |
T |
|
| Q |
114 |
aactttatcccatatcaaatatgg |
137 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38712135 |
aactttatcccatatcaaatatgg |
38712112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University