View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_high_11 (Length: 385)
Name: NF1780_high_11
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 31658807 - 31658583
Alignment:
| Q |
14 |
taaggaagagattcatgatgattattcttctcaaaatcaattgttctcatcagataacctcatatcatgtaactttgaattttgttttgattatttgaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
31658807 |
taaggaagagattcatgatgattattcttctcaaaatcaattgttctcatcagataacctcatatcatgtaactttgaagtttattttgattatttgaga |
31658708 |
T |
 |
| Q |
114 |
catgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaa |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658707 |
cgtgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaa |
31658608 |
T |
 |
| Q |
214 |
atttattttcaaagtttggcattgg |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31658607 |
atttattttcaaagtttggcattgg |
31658583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 340 - 377
Target Start/End: Complemental strand, 31658558 - 31658521
Alignment:
| Q |
340 |
taatgggagatttatttgatcgtttaactgatgatgtc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaacttatgatgtc |
31658521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University