View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_high_20 (Length: 332)
Name: NF1780_high_20
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 3571879 - 3572181
Alignment:
| Q |
17 |
agtagtacaatacaatctttgtctctctttttaataatgaatgaccattcgtgctcaccgtttgatgatatgatcaatgtttcattctctttcacttttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3571879 |
agtagtacaatacaatctttgtctctctttttaataatgaatgaccattcgtgctcaccgtttgatgatatgatcaatgtttcattctctttcacttttt |
3571978 |
T |
 |
| Q |
117 |
ccaatcccgggcccggcaaccgcaaacgttaacaccaaataatcattcttttggcgtcatcatcagttgctggtgggtggaatatctctctctctaacat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3571979 |
ccaatcccgggcccggcaaccgcaaacgttaacaccaaataatcattcttttggcgtcatcatcagttgctggtgggtggaata--tctctctctaacat |
3572076 |
T |
 |
| Q |
217 |
tcnnnnnnnatgaactcaaagcttttccagtaatctagctccaactcaatagataaggagagagaaactgtaatttgagagtgacgctttattagggttt |
316 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3572077 |
t-tttttttatgaactcaaagcttttccagtaatctagctccaactcaatagataaggagagagaaactttaatttgagagtgacgctttattagggttt |
3572175 |
T |
 |
| Q |
317 |
cttcat |
322 |
Q |
| |
|
|||||| |
|
|
| T |
3572176 |
cttcat |
3572181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University